Review



gapdh proteintech group  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Proteintech gapdh proteintech group
    Gapdh Proteintech Group, supplied by Proteintech, used in various techniques. Bioz Stars score: 97/100, based on 6118 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+proteintech+group/GAPDH+Polyclonal+antibody/pmc12555889__Supplementary_Data2-4-0-1
    Average 97 stars, based on 6118 article reviews
    gapdh proteintech group - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Negative Control:

    Article Title: PLIN5 deficiency ameliorates metabolic dysfunction-associated fatty liver disease by inhibiting ferroptosis
    Article Snippet: .. GAPDH Proteintech Group, Inc. 10494-1-AP 1:5,000 ATF3 Zen-Bio, Inc. R26444 1:500 CHOP Shanghai Abways Biotechnology Co., Ltd. CY6694 1:1,000 CHAC1 Proteintech Group, Inc. 15207-1-AP 1:2,000 α-tubulin Proteintech Group, Inc. 11224-1-AP 1:5,000 GPX4 Shanghai Abways Biotechnology Co., Ltd. CY6959 1:1,000 PLIN5 Proteintech Group, Inc. 26951-1-AP 1:2,000 Goat anti-rabbit Proteintech Group, Inc. SA00001-2 1:5,000 ATF3, activating transcription factor 3; CHAC1, cation transport regulator-like protein 1; CHOP, C/EBP homologous protein; GPX4, glutathione peroxidase 4; PLIN5, perilipin 5. shNC TTCTCCGAACGTGTCACGT shATF3 AGACGAGAGGAACCTCTTTAT ATF3, activating transcription factor 3; NC, negative control; sh, short hairpin. ..

    Phospho-proteomics:

    Article Title: Anti‑epileptic mechanism of isopimaric acid from Platycladi cacumen based on network pharmacology, molecular docking and biological validation.
    Article Snippet: .. Antibody Supplier Cat. no. Dilution Rabbit anti‐TNF‐1α Cell Signaling Technology, Inc. 8184 1:1,000 Rabbit anti‐IL‐1β Cell Signaling Technology, Inc. 12703S 1:1,000 Mouse anti‐AKT Proteintech Group, Inc. 60203‐2 1:5,000 Rabbit anti‐p‐AKT Proteintech Group, Inc. 80455‐1‐RR 1:5,000 Rabbit anti‐mTOR Abcam ab2732 1:5,000 Mouse anti‐p‐mTOR Proteintech Group, Inc. 67778‐1 1:2,000 Mouse anti‐PI3Kα Proteintech Group, Inc. 67071‐1‐lg 1:1,000 Mouse anti‐PI3Kβ Proteintech Group, Inc. 67644‐1‐lg 1:5,000 Rabbit anti‐GAPDH Proteintech Group, Inc. 10494‐1‐AP 1:6,000 PI3K, phosphatidylinositol 3‐kinase; p‐, phosphorylation. (Fig. 1C). ..



    Similar Products

    97
    Proteintech gapdh proteintech group
    Gapdh Proteintech Group, supplied by Proteintech, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+proteintech+group/GAPDH+Polyclonal+antibody/pmc12555889__Supplementary_Data2-4-0-1
    Average 97 stars, based on 1 article reviews
    gapdh proteintech group - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    98
    Proteintech anti gapdh proteintech group
    Anti Gapdh Proteintech Group, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+proteintech+group/GAPDH+Monoclonal+antibody/pmc12609087__sciadv%2Eadz3680_sm-79-113-114
    Average 98 stars, based on 1 article reviews
    anti gapdh proteintech group - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Proteintech form proteintech group
    Form Proteintech Group, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+proteintech+group/GAPDH+Monoclonal+antibody/pm41225541-72-33-34
    Average 98 stars, based on 1 article reviews
    form proteintech group - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Proteintech primary gapdh proteintech group
    Primary Gapdh Proteintech Group, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+proteintech+group/GAPDH+Monoclonal+antibody/pmc12030921__Supplementary_Data2-3-42-44
    Average 98 stars, based on 1 article reviews
    primary gapdh proteintech group - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Proteintech gapdh 60004 1 ig proteintech group
    Gapdh 60004 1 Ig Proteintech Group, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+proteintech+group/GAPDH+Monoclonal+antibody/pmc10836505__Supplementary_Data2-14-47-49
    Average 98 stars, based on 1 article reviews
    gapdh 60004 1 ig proteintech group - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Proteintech trib3 co ip proteintech group 13300 1 ap trib3 western blot cst
    Fig. 6 FTO influenced proliferation and migration by affecting the expression of <t>TRIB3.</t> A-D Overexpression of TRIB3 rescued the proliferative activity of HaCaT and NHEK cells with FTO knockout, as reflected by CCK-8 and colony formation assays. Semi-quantitative analysis of colony formation assays is shown (n = 3). E, F The Edu incorporation assays revealed that FTO significantly inhibits proliferation of keratinocytes, which can be rescued by overexpression of TRIB3. G, H Overexpression of TRIB3 during FTO knockdown partially rescued the migration of keratinocytes. Images were captured at 0 h and 12 h after the scratch. Semi-quantitative analysis of wound-healing assays is shown (n = 3). I Timeline of in vivo experiments for STZ injections, sgRNA and vector injections, and observation of wound healing models in mice. J Measurements of blood glucose levels in STZ-treated mice. K-M Representative images of cutaneous wounds of diabetic mice, diabetic mice with koFTO injections, diabetic mice with oeTRIB3 injections, and diabetic mice with koFTO and oeTRIB3 injections on days 0, 4, 8, and 12 after wound generation by surgical excision. Rates of wound closure were quantified using ImageJ software and expressed as the percentage of closed wound area (n = 5 per group). The data are presented as the mean ± SD or mean ± SEM (A, B, D, F, H, J, M), and P-values of all data by a two-tailed unpaired t-test are indicated. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
    Trib3 Co Ip Proteintech Group 13300 1 Ap Trib3 Western Blot Cst, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+proteintech+group/GAPDH+Monoclonal+antibody/pm40157922-350-36-38
    Average 98 stars, based on 1 article reviews
    trib3 co ip proteintech group 13300 1 ap trib3 western blot cst - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Proteintech df4294 anti gapdh proteintech group 60004 1 ig ful unedited blot
    Fig. 6 FTO influenced proliferation and migration by affecting the expression of <t>TRIB3.</t> A-D Overexpression of TRIB3 rescued the proliferative activity of HaCaT and NHEK cells with FTO knockout, as reflected by CCK-8 and colony formation assays. Semi-quantitative analysis of colony formation assays is shown (n = 3). E, F The Edu incorporation assays revealed that FTO significantly inhibits proliferation of keratinocytes, which can be rescued by overexpression of TRIB3. G, H Overexpression of TRIB3 during FTO knockdown partially rescued the migration of keratinocytes. Images were captured at 0 h and 12 h after the scratch. Semi-quantitative analysis of wound-healing assays is shown (n = 3). I Timeline of in vivo experiments for STZ injections, sgRNA and vector injections, and observation of wound healing models in mice. J Measurements of blood glucose levels in STZ-treated mice. K-M Representative images of cutaneous wounds of diabetic mice, diabetic mice with koFTO injections, diabetic mice with oeTRIB3 injections, and diabetic mice with koFTO and oeTRIB3 injections on days 0, 4, 8, and 12 after wound generation by surgical excision. Rates of wound closure were quantified using ImageJ software and expressed as the percentage of closed wound area (n = 5 per group). The data are presented as the mean ± SD or mean ± SEM (A, B, D, F, H, J, M), and P-values of all data by a two-tailed unpaired t-test are indicated. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
    Df4294 Anti Gapdh Proteintech Group 60004 1 Ig Ful Unedited Blot, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+proteintech+group/GAPDH+Monoclonal+antibody/pmc11567942__CNS___30___e70111___s001-0-9-11
    Average 98 stars, based on 1 article reviews
    df4294 anti gapdh proteintech group 60004 1 ig ful unedited blot - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    90
    Proteintech gapdh, proteintech group, 60004-1-ig antibody

    Gapdh, Proteintech Group, 60004 1 Ig Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+proteintech+group/gapdh+antibody/pmc11546291-8-0-2
    Average 90 stars, based on 1 article reviews
    gapdh, proteintech group, 60004-1-ig antibody - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Fig. 6 FTO influenced proliferation and migration by affecting the expression of TRIB3. A-D Overexpression of TRIB3 rescued the proliferative activity of HaCaT and NHEK cells with FTO knockout, as reflected by CCK-8 and colony formation assays. Semi-quantitative analysis of colony formation assays is shown (n = 3). E, F The Edu incorporation assays revealed that FTO significantly inhibits proliferation of keratinocytes, which can be rescued by overexpression of TRIB3. G, H Overexpression of TRIB3 during FTO knockdown partially rescued the migration of keratinocytes. Images were captured at 0 h and 12 h after the scratch. Semi-quantitative analysis of wound-healing assays is shown (n = 3). I Timeline of in vivo experiments for STZ injections, sgRNA and vector injections, and observation of wound healing models in mice. J Measurements of blood glucose levels in STZ-treated mice. K-M Representative images of cutaneous wounds of diabetic mice, diabetic mice with koFTO injections, diabetic mice with oeTRIB3 injections, and diabetic mice with koFTO and oeTRIB3 injections on days 0, 4, 8, and 12 after wound generation by surgical excision. Rates of wound closure were quantified using ImageJ software and expressed as the percentage of closed wound area (n = 5 per group). The data are presented as the mean ± SD or mean ± SEM (A, B, D, F, H, J, M), and P-values of all data by a two-tailed unpaired t-test are indicated. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

    Journal: Cell death & disease

    Article Title: RNA N 6 -methyladenosine demethylase FTO promotes diabetic wound healing through TRIB3-mediated autophagy in an m 6 A-YTHDF2-dependent manner.

    doi: 10.1038/s41419-025-07494-3

    Figure Lengend Snippet: Fig. 6 FTO influenced proliferation and migration by affecting the expression of TRIB3. A-D Overexpression of TRIB3 rescued the proliferative activity of HaCaT and NHEK cells with FTO knockout, as reflected by CCK-8 and colony formation assays. Semi-quantitative analysis of colony formation assays is shown (n = 3). E, F The Edu incorporation assays revealed that FTO significantly inhibits proliferation of keratinocytes, which can be rescued by overexpression of TRIB3. G, H Overexpression of TRIB3 during FTO knockdown partially rescued the migration of keratinocytes. Images were captured at 0 h and 12 h after the scratch. Semi-quantitative analysis of wound-healing assays is shown (n = 3). I Timeline of in vivo experiments for STZ injections, sgRNA and vector injections, and observation of wound healing models in mice. J Measurements of blood glucose levels in STZ-treated mice. K-M Representative images of cutaneous wounds of diabetic mice, diabetic mice with koFTO injections, diabetic mice with oeTRIB3 injections, and diabetic mice with koFTO and oeTRIB3 injections on days 0, 4, 8, and 12 after wound generation by surgical excision. Rates of wound closure were quantified using ImageJ software and expressed as the percentage of closed wound area (n = 5 per group). The data are presented as the mean ± SD or mean ± SEM (A, B, D, F, H, J, M), and P-values of all data by a two-tailed unpaired t-test are indicated. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

    Article Snippet: Target Application Supplier Catalog Number FTO Western blot/IHC/IF Abcam ab126605 FTO Western blot/IHC/IF Novus NBP1-77021 m6A Dot blot/IF Synaptic Systems 202 003 cytokeratin IF ORIGENE BP5069 SQSTM1 Western blot/CO-IP/IF CST #23214 LC3A/B Western blot/IHC CST #12741 TRIB3 CO-IP Proteintech Group 13300-1-AP TRIB3 Western blot CST #43043 YTHDF2 Western blot/ CO-IP Proteintech Group 24744-1-AP HA-Tag Western blot Abmart M20003 ATG5 Western blot Abmart T55766 ATG7 Western blot Abmart T55658 ULK1 Western blot Abmart T56902 IgG RIP/Co-IP Abcam ab172730 GAPDH Western blot Proteintech Group 60004-1-Ig ACTB Western blot Proteintech Group 60008-1-Ig Table.

    Techniques: Migration, Expressing, Over Expression, Activity Assay, Knock-Out, CCK-8 Assay, Knockdown, In Vivo, Plasmid Preparation, Software, Two Tailed Test

    Fig. 7 FTO regulated autophagy by targeting TRIB3, which inhibited autophagic degradation by interacting with SQSTM1. A, B TRIB3, SQSTM1, LC3I, and LC3II protein levels were measured by western blot in HaCaT and NHEK cells transfected with lentiviruses carrying koFTO and/or oeTRIB3 (n = 3). C–E The HaCaT and NHEK cells were infected with adenovirus harboring tandem fluorescent mRFP-GFP-LC3 for 24 h, followed by transfection with oeTRIB3, koFTO, and koFTO with oeTRIB3 in normal-glucose culture medium. Representative images of the HaCaT and NHEK cells expressing mRFP-GFP-LC3 are shown. Green: GFP puncta; red: mRFP puncta. Semi-quantitative analysis of autophagosomes (AP, yellow puncta in merged images) and autolysosomes (AL, red-only puncta in merged images, n = 10 randomly selected conditions from 3 independent experiments, Scale bar, 50 μm). F The TRIB3-SQSTM1 interaction was evaluated by an IP assay in TRIB3- overexpressing HaCaT cells (n = 3). G, I Colocalization of TRIB3 and SQSTM1 was detected by immunostaining in control and TRIB3- overexpressing HaCaT and NHEK cells. H, J Line chart of fluorescence signal positioning analysis (n = 3; Scale bar, 10 μm). K–M Expression of TRIB3 and colocalization of TRIB3 with SQSTM1 in Con and DW tissues were detected by immunostaining. (n = 5 per group; Scale bar, 50 μm). The data are presented as the mean ± SD or mean ± SEM (B, D, E), and P-values of all data by a two-tailed unpaired t-test are indicated. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

    Journal: Cell death & disease

    Article Title: RNA N 6 -methyladenosine demethylase FTO promotes diabetic wound healing through TRIB3-mediated autophagy in an m 6 A-YTHDF2-dependent manner.

    doi: 10.1038/s41419-025-07494-3

    Figure Lengend Snippet: Fig. 7 FTO regulated autophagy by targeting TRIB3, which inhibited autophagic degradation by interacting with SQSTM1. A, B TRIB3, SQSTM1, LC3I, and LC3II protein levels were measured by western blot in HaCaT and NHEK cells transfected with lentiviruses carrying koFTO and/or oeTRIB3 (n = 3). C–E The HaCaT and NHEK cells were infected with adenovirus harboring tandem fluorescent mRFP-GFP-LC3 for 24 h, followed by transfection with oeTRIB3, koFTO, and koFTO with oeTRIB3 in normal-glucose culture medium. Representative images of the HaCaT and NHEK cells expressing mRFP-GFP-LC3 are shown. Green: GFP puncta; red: mRFP puncta. Semi-quantitative analysis of autophagosomes (AP, yellow puncta in merged images) and autolysosomes (AL, red-only puncta in merged images, n = 10 randomly selected conditions from 3 independent experiments, Scale bar, 50 μm). F The TRIB3-SQSTM1 interaction was evaluated by an IP assay in TRIB3- overexpressing HaCaT cells (n = 3). G, I Colocalization of TRIB3 and SQSTM1 was detected by immunostaining in control and TRIB3- overexpressing HaCaT and NHEK cells. H, J Line chart of fluorescence signal positioning analysis (n = 3; Scale bar, 10 μm). K–M Expression of TRIB3 and colocalization of TRIB3 with SQSTM1 in Con and DW tissues were detected by immunostaining. (n = 5 per group; Scale bar, 50 μm). The data are presented as the mean ± SD or mean ± SEM (B, D, E), and P-values of all data by a two-tailed unpaired t-test are indicated. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

    Article Snippet: Target Application Supplier Catalog Number FTO Western blot/IHC/IF Abcam ab126605 FTO Western blot/IHC/IF Novus NBP1-77021 m6A Dot blot/IF Synaptic Systems 202 003 cytokeratin IF ORIGENE BP5069 SQSTM1 Western blot/CO-IP/IF CST #23214 LC3A/B Western blot/IHC CST #12741 TRIB3 CO-IP Proteintech Group 13300-1-AP TRIB3 Western blot CST #43043 YTHDF2 Western blot/ CO-IP Proteintech Group 24744-1-AP HA-Tag Western blot Abmart M20003 ATG5 Western blot Abmart T55766 ATG7 Western blot Abmart T55658 ULK1 Western blot Abmart T56902 IgG RIP/Co-IP Abcam ab172730 GAPDH Western blot Proteintech Group 60004-1-Ig ACTB Western blot Proteintech Group 60008-1-Ig Table.

    Techniques: Western Blot, Transfection, Infection, Expressing, Immunostaining, Control, Two Tailed Test

    Fig. 8 Proposed working models of FTO in the regulation of autophagy in keratinocytes of diabetic skin. The expression of TRIB3 was regulated by FTO, and it interacted and cooperated with SQSTM1 to induce autophagy in keratinocytes. In diabetes, downregulation of FTO induced decreased expression levels of TRIB3 via acceleration of TRIB3 mRNA decay, which led to the inhibition of autophagy and the impairment of keratinocyte migration, eventually resulting in delayed wound healing.

    Journal: Cell death & disease

    Article Title: RNA N 6 -methyladenosine demethylase FTO promotes diabetic wound healing through TRIB3-mediated autophagy in an m 6 A-YTHDF2-dependent manner.

    doi: 10.1038/s41419-025-07494-3

    Figure Lengend Snippet: Fig. 8 Proposed working models of FTO in the regulation of autophagy in keratinocytes of diabetic skin. The expression of TRIB3 was regulated by FTO, and it interacted and cooperated with SQSTM1 to induce autophagy in keratinocytes. In diabetes, downregulation of FTO induced decreased expression levels of TRIB3 via acceleration of TRIB3 mRNA decay, which led to the inhibition of autophagy and the impairment of keratinocyte migration, eventually resulting in delayed wound healing.

    Article Snippet: Target Application Supplier Catalog Number FTO Western blot/IHC/IF Abcam ab126605 FTO Western blot/IHC/IF Novus NBP1-77021 m6A Dot blot/IF Synaptic Systems 202 003 cytokeratin IF ORIGENE BP5069 SQSTM1 Western blot/CO-IP/IF CST #23214 LC3A/B Western blot/IHC CST #12741 TRIB3 CO-IP Proteintech Group 13300-1-AP TRIB3 Western blot CST #43043 YTHDF2 Western blot/ CO-IP Proteintech Group 24744-1-AP HA-Tag Western blot Abmart M20003 ATG5 Western blot Abmart T55766 ATG7 Western blot Abmart T55658 ULK1 Western blot Abmart T56902 IgG RIP/Co-IP Abcam ab172730 GAPDH Western blot Proteintech Group 60004-1-Ig ACTB Western blot Proteintech Group 60008-1-Ig Table.

    Techniques: Expressing, Inhibition, Migration

    Journal: iScience

    Article Title: SIRT3 differentially regulates lysine benzoylation from SIRT2 in mammalian cells

    doi: 10.1016/j.isci.2024.111176

    Figure Lengend Snippet:

    Article Snippet: GAPDH , Proteintech Group , 60004-1-Ig; RRID: AB_2107436.

    Techniques: Virus, Recombinant, Protease Inhibitor, Transfection, Kinase Assay, shRNA, Sequencing, Plasmid Preparation, Modification, Software